helix

Exceptional Chromosome Regions II

Home

 

Gap Closing of Chromosome 16 with Unigene Sequences

Cliff Han and Norman Doggett
Los Alamos National Laboratory

825 Unigenes from chromosome 16 were BLAST against the draft and finished contigs of this chromosome. 41 unigene clusters (5%) did not hit with a similar genomic sequence using a cut-off of >97% identity and >70 bp in length. These 41 sequence were then searched against the whole human genome draft and finished contigs, and 7 of these are located on other chromosomes (1, 14, 5, 17, 19). Of the remaining 34 Unigene clusters without chromosome 16 genomic sequence one is LTR repeat, and two have poor sequence quality leaving 31 clusters for use in BAC library screening. The resulting numbers (784/815 Unigene clusters which match chromosome 16 genomic sequence) suggest that there is 96.2% coverage of the chromosome represented in the draft and finished public databases. We have selected PCR primers for the 31 Unigenes that have potential to close gaps in the 16 map and will use these to screen the RPCI-11 library. This primer list is attached.

Hs.1137.LEFT
Hs.1137.RIGHT
Hs.3076.LEFT
Hs.3076.RIGHT
Hs.3112.LEFT
Hs.3112.RIGHT
Hs.8040.LEFT
Hs.8040.RIGHT
Hs.9003.LEFT
Hs.9003.RIGHT
Hs.9204.LEFT
Hs.9204.RIGHT
Hs.9605.LEFT
Hs.9605.RIGHT
Hs.74170.LEFT
Hs.74170.RIGHT
Hs.75124.LEFT
Hs.75124.RIGHT
Hs.75648.LEFT
Hs.75648.RIGHT
Hs.91910.LEFT
Hs.91910.RIGHT
Hs.96023.LEFT
Hs.96023.RIGHT
Hs.99880.LEFT
Hs.99880.RIGHT
Hs.118786.LEFT
Hs.118786.RIGHT
Hs.122823.LEFT
Hs.122823.RIGHT
Hs.145271.LEFT
Hs.145271.RIGHT
Hs.157113.LEFT
Hs.157113.RIGHT
Hs.169850.LEFT
Hs.169850.RIGHT
Hs.183075.LEFT
Hs.183075.RIGHT
Hs.189762.LEFT
Hs.189762.RIGHT
Hs.203936.LEFT
Hs.203936.RIGHT
Hs.241388.LEFT
Hs.241388.RIGHT
Hs.250760.LEFT
Hs.250760.RIGHT
Hs.275462.LEFT
Hs.275462.RIGHT
Hs.275675.LEFT
Hs.275675.RIGHT
Hs.278462.LEFT
Hs.278462.RIGHT
Hs.331895.LEFT
Hs.331895.RIGHT
Hs.332417.LEFT
Hs.332417.RIGHT
Hs.158336.LEFT
Hs.158336.RIGHT
Hs.1973.LEFT
Hs.1973.RIGHT
Hs.76159.LEFT
Hs.76159.RIGHT
TGTTCAGCCTGCCTTCTTTT
CTCTTTAAGGAGATGGGGGC
TTGTTTGGGGATGAGAAAGG
CCTCTTGACACCCAGCTCTC
GCATCCAATTCGTGTCTGTG
GAGGGGTCAGCTCTGTCTTG
GTCCCTTCCCATCAGTTTGA
ACACGGTTTTCATTTAGCGG
GTGTTCTGTGCCTGTGTGCT
GATTAAAGCCTCCCAAAGCC
CACCTTCATCACCCACCTCT
CAGACCGTCCACTTCCACTT
AATGCACCAGGATATGGACC
TGTGCTCACAGAGACAAGCG
AGTGACGCGACAACAGACAC
GGTTGTGAGCTATCCGTGGT
GCCTCCATCCCTGATTCTAA
GGGAAGGGGTTTGATCTTTC
GCCCTATTCACACTCTGGGA
GGAACATGAGAGGCCAAAAA
TCCTTCAGGAAGCCACTCTC
CATCATCACATGAACCCTGC
GGACCCAATCATGAGGAAGA
TGAATCTTGGGGACTTGAGG
CTTTGGGCCTATAGGGGTGT
TAAATTAGCGCAAAATGGGG
GACATTACGCGAAGCACTCA
TTTGTTCTGACTGTCGCCTG
CCCCTCAGACCTCCTCATCT
CTCCCTCCTTTCCTAGGTGG
CTCAGGAACAAGGGGAAACA
GTTCCCAAAAACCCCTTCAG
GGGTGGAGTTCAGGATCAGA
GTCCTGCCAAGTCATCAGGT
CAAACATCAGAGCAATCCGA
TAGGGGGTCGTATGATCAGG
ACCTCATTTCCTCCAACGTG
ATGTAGCGGAAGAAGAGCCA
CACAGGTGTGGGTCTCTCAA
TTTTTCCCACTGTGGTGTCA
GGACCCCAACTGCTCCTG
AGGAGCAGCAGCTCTTCTTG
TCCAACGCTTATGGGCTATC
CAGCGACCACTGGAATCATA
CATCATGGCTTTGCCTCTG
TGTTGGTAGGGACGGAACTC
GTGGCCATTAGCTTGGTGTT
TGCCTTGCACACTAAGGTCC
GCCAGTCTGGACTGAGGAAA
GTTCAGGGCTGTAGAGGTGG
CTTCTCCTTGCCTCGAAATG
AGGAGCAGCAGCTCTTCTTG
AGAAGCACATGGGGGTATTG
GGACCCATTGTTCTGTGCTT
CAAAGAGGGGCTTAGCACAG
TTCAACTTTGCAAGAGGGCT
GAAGCCTCGTGCTACCCTG
TAGATGTGGGAGCAGCGG
CTGTGAGCACACCACTGTCC
CTGTGGGTCACATACGAACG
ATCCTAGTGCCCATCGTCTG
GGCGACACACAAGCTAAGGT

 



Last modified:

Base URL: www.ornl.gov/meetings/ecr2/

Site sponsored by the U.S. Department of Energy Office of Science, Office of Biological and Environmental Research, Human Genome Program